Cti-MIRN539e

Basic info.

• miRNA locus ID
• Cti-MIRN539e

• miRNA locus accession
• PmiREN003480

• Organism
• Carthamus tinctorius

• Genomic location
• Cti-LUCG01199688.1  136  308  +

• Comments
• A member of family MIRN539

• Confidence level
• 

Secondary strurture and sequence

  GAAGTAGATAAGTGATCTCC                ----------NC        GTCACCCTCCTTGAATCGTCTCCACCCTC   GAATCGCGTCAATGCT
                      ACCACTCATCCGGTCA            TTGACCGG                             CAT                
                      ||||||||||||||||            ||||||||                             |||                 
                      TGGTGAGTAGGCCAGT            AACTGGCC                             TGC                
CTCTTCGCCTCTTCACTAGAAA                TATTTCCGCCAA        ---------------------------AA   CACCTGCGCTAGTGCT

• Get mature sequence
• Get star sequence
• Get miRNA stem-loop seqence
• Get miRNA stem-loop ± 20bp
• Get dot-bracket miRNA secondary structure

miRNA cluster info.

• Cluster ID: 
• Chromosome: 
• Cluster start: 
• Cluster end: 

Expression info.

Pri-miRNA expression [+]

Mature miRNA expression [+]

Target gene info.[+]